NEET Exam  >  NEET Notes  >  Biology Class 12  >  NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance

NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12 PDF Download

Q.1. Unequivocal proof that DNA is the genetic material was first proposed by     (NEET 2023)
(a) Frederick Griffith
(b) Alfred Hershey and Martha Chase
(c) Avery, Macleoid and McCarthy
(d) Wilkins and Franklin

Ans. b

The unequivocal proof that DNA is the genetic material came from the experiment of Alfred Hershey and Martha Chase.
Avery, Macleoid and McCarty gave the biochemical characterisation of Transforming Principle.
The transformation experiments by using Pneumococcus was conducted by Frederick Griffith.
Wilkins and Franklin produced X-ray diffraction data of DNA.


Q.2.  What is the role of RNA polymerase III in the process of transcription in Eukaryotes?     (NEET 2023)
(a) Transcription of rRNAs (28S, 18S and 5.8S)
(b) Transcription of tRNA, 5S rRNA and snRNA
(c) Transcription of precursor of mRNA
(d) Transcription of only snRNAs

Ans. b

In eukaryotes there are three major types of RNA polymerases.

RNA polymerase I transcribes : 5.8S, 18S, 28S rRNAs 

RNA polymerase II transcribes : hnRNAs (precurssor of mRNA) 

RNA polymerase III transcribes : tRNAs, ScRNA, 5S rRNA and snRNA


Q.3.  Expressed Sequence Tags (ESTs) refers to      (NEET 2023)
(a) All genes that are expressed as RNA.
(b) All genes that are expressed as proteins.
(c) All genes whether expressed or unexpressed.
(d) Certain important expressed genes.
Ans.
a

All the genes that are expressed as RNA are referred to as Expressed Sequence Tags (ESTs).


Q.4.  How many different proteins does the ribosome consist of?      (NEET 2023)
(a) 80
(b) 60
(c) 40
(d) 20
Ans.
a

The ribosome consists of structural RNAs and about 80 different proteins.


Q.5.   Match List I with List II.      (NEET 2023)
NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12
Choose the correct answer from the options given below:
(a) A-II, B-I, C-IV, D-III
(b) A-II, B-III, C-IV, D-I
(c) A-III, B-IV, C-I, D-II
(d) A-III, B-I, C-IV, D-II

Ans. b

In a lac operon, Gene a codes for enzyme transacetylase.

Gene y codes for enzyme permease.

Gene i codes for repressor protein Gene z codes for enzyme -galactosidase.


Q.6.  Given below are two statements:      (NEET 2023)
Statement I: In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II: In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below:
(a) Both Statement I and Statement II are true.
(b) Both Statement I and Statement II are false.
(c)Statement I is correct but Statement II is false.
(d) Statement I is incorrect but Statement II is true.

Ans. d

In prokaryotes, the negatively charged DNA is held with some positively charged proteins in a region termed as nucleoid.

In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleosome.



Q.7.  Given below are two statements:      (NEET 2023)
Statement I: a protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end is represented by last amino acid (N-terminal)
Statement II: adult human haemoglobin, consists of 4 subunits ( 2 subunits of ɑ-type and 2 subunits of 𝛃-type)

In the light of the above statements, choose the correct answer from the options given below:
(a) Both Statement I and Statement II are true.
(b) Both Statement I and Statement II are false.
(c) Statement I is true but Statement II is false.
(d) Statement I is false but Statement II is true.

Ans. d

The correct answer is option (d) as a protein is imagined as a line, the left end represented by the first amino acid and the right end is represented by the last amino acid. The first amino acid is also called N-terminal amino acid. The last amino acid is called the C-terminal amino acid.


Q.8.  Given below are two statements:      (NEET 2023)
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
(a) Both Statement I and Statement II are true.
(b) Both Statement I and Statement II are false.
(c) Statement I is true but Statement II is false.
(d) Statement I is false but Statement II is true.

Ans. a

RNA being unstable, mutate at a faster rate. Consequently, viruses having RNA genome and having shorter life span mutate and evolve faster.


Q.9.  Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5’AUCGAUCGAUCGAUCGAUCGAUCG AUCG 3’?      (NEET 2023)
(a)    5’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3’
(b)    3’ UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5’
(c)    5’ ATCGATCGATCGATCGATCGATCGATCG 3’
(d)    3’ ATCGATCGATCGATCGATCGATCGATCG 5’

Ans. c

The sequence of coding strand is same as RNA except thymine at the place of uracil.

NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12


Q.10. The process of translation of mRNA to proteins begins as soon as:    (NEET 2022)
(a) The larger subunit of ribosome encounters mRNA
(b) Both the subunits join together to bind with mRNA
(c) The tRNA is activated and the larger subunit of ribosome encounters mRNA
(d) The small subunit of ribosome encounters mRNA

Ans. d
The cellular factory responsible for synthesising proteins is the ribosome. The ribosome consists of structural RNAs and about 80 different proteins. In its inactive state, it exists as two subunits; a large subunit and a small subunit. When the small subunit encounters an mRNA, the process of translation of the mRNA to protein begins.


Q.11. Read the following statements and choose the set of correct statements:    (NEET 2022)
(A) Euchromatin is loosely packed chromatin
(B) Heterochromatin is transcriptionally active
(C) Histone octomer is wrapped by negatively charged DNA in nucleosome
(D) Histones are rich in lysine and arginine
(E) A typical nucleosome contains 400 bp of DNA helix
Choose the correct answer from the options given below:
(a) (A), (C), (D) Only
(b) (B), (E) Only
(c) (A), (C), (E) Only
(d) (B), (D), (E) Only

Ans. a
In a typical nucleus, some region of chromatin are loosely packed (and stains light) and are referred to as euchromatin. The chromatin that is more densely packed and stains dark are called as Heterochromatin. Euchromatin is said to be transcriptionally active chromatin, whereas heterochromatin is inactive.
In eukaryotes, this organisation is much more complex. There is a set of positively charged, basic proteins called histones. A protein acquires charge depending upon the abundance of amino acids residues with charged side chains. Histones are rich in the basic amino acid residues lysine and arginine.


Q.12. DNA Polymorphism forms the basis of:    (NEET 2022)
(a) DNA finger printing
(b) Both genetic mapping and DNA finger printing
(c) Translation
(d) Genetic mapping

Ans. b
As polymorphism in DNA sequence is the basis of genetic mapping of human genome as well as of DNA fingerprinting. Polymorphism (variation at genetic level) arises due to mutations. New mutations may arise in an individual either in somatic cells or in the germ cells. If a germ cell mutation does not seriously impair individual’s ability to have offspring who can transmit the mutation, it can spread to the other members of population (through sexual reproduction).


Q.13. In an E. coli strain, i gene gets mutated, and its product cannot bind the inducer molecule. If the growth medium is provided with lactose, what will be the outcome?    (NEET 2022)
(a) a genes will be transcribed
(b) a genes will not be translated
(c) RNA polymerase will bind the promoter region
(d) Only gene will get transcribed

Ans. a
NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12
Given above is the functioning of the normal lac operon in E. coli. The question says that due to mutation, the product of i gene which is the repressor, cannot bind to the inducer molecule which is lactose. The repressor gene binds to the operator region and does not allow the binding of RNA polymerase to the promoter region in the mRNA molecule. If the repressor is absent, then it will not bind to the operator, the binding of RNA polymerase to the promoter region will be open always and there will be the transcription of lac z, y, and a genes.


Q.14. If the length of a DNA molecule is 1.1 metres, what will be the approximate number of base pairs?    (NEET 2022)
(a) 6.6 x 109 bp
(b) 3.3 x 106 bp
(c) 6.6 x 106 bp
(d) 3.3 x 109 bp

Ans. d
The two chains of DNA are coiled in a right-handed helicle fashion. The pitch of the helix is 3.4 nm and has a diameter of 2 nm. In the B-form of DNA, the distance between a bp in a helix is approximately 0.34 nm which means there are about 10 nucleotides present in a complete turn.
The total length of DNA molecule in nm = 1.1 × 109 nm.
The approximate number of base pairs = 1.1 × 109/ 0.34
= 3.3 × 10


Q.15. Complete the flow chart on central dogma    (NEET 2021)
NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12
(a) (a) - Replication; (b) - Transcription;
     (c) - Translation; (d) -  Protein

(b) (a) - Transduction; (b) - Translation;
     (c) - Replication;  (d) - Protein

(c) (a) - Replication; (b) - Transcription;
     (c) - Transduction; (d) - Protein

(d) (a) - Transcription; (b) - Replication;
     (c) - Transcription; (d) - Transduction

Ans. a
Very soon, Francis Crick proposed the Central dogma in molecular biology, which states that the genetic information flows from DNA->RNA->Protein.


Q.16. What is the role of RNA polymerase III in the process of transcription in eukaryotes?    (NEET 2021)
(a) Transcribes precursor of mRNA
(b) Transcribes only snRNAs
(c) Transcribes rRNAs (28S, 18S, and 5.8S)
(d) Transcribes tRNA, 5s rRNA and snRNA

Ans. d
The RNA polymerase I transcribes rRNAs (28S, 18S, and 5.8S), whereas the RNA polymerase III is responsible for transcription of tRNA, 5srRNA, and snRNAs (small nuclear RNAs).


Q.17. DNA fingerprinting involves identifying differences in some specific regions in DNA sequence, called as    (NEET 2021)
(a) Single nucleotides
(b) Polymorphic DNA
(c) Satellite DNA
(d) Repetitive DNA

Ans. d
DNA fingerprinting involves identifying differences in some specific regions in DNA sequence called as repetitive DNA, because in these sequences, a small stretch of DNA is repeated many times.


Q.18. Identify the correct statement.    (NEET 2021)
(a) The coding strand in a transcription unit is copied to an mRNA.
(b) Split gene arrangement is characteristic of prokaryotes.
(c) In capping, methylguanosine triphosphate is added to the 3' end of hnRNA.
(d) RNA polymerase binds with the Rho factor to terminate the process of transcription in bacteria.

Ans. d
The RNA polymerase is only capable of catalysing the process of elongation.

It associates transiently with initiation-factor (σ) and termination-factor (ρ) to initiate and terminate the transcription, respectively.


Q.19. If Adenine makes 30% of the DNA molecule, what will be the percentage of Thymine, Guanine and Cytosine in it?    (NEET 2021)
(a) T:30 ; G:20 ; C:20
(b) T:20 ; G:25 ; C:25
(c) T:20 ; G:30 ; C:20
(d) T:20 ; G:20 ; C:30

Ans. a

  • However, this proposition was also based on the observation of Erwin Chargaff that for a double stranded DNA, the ratios between Adenine and Thymine and Guanine and Cytosine are constant and equals one.
    Adenine forms two hydrogen bonds with Thymine from opposite strand and vice-versa.
  • Similarly, Guanine is bonded with Cytosine with three H-bonds.


Q.20. Which of the following RNAs is not required for the synthesis of protein?    (NEET 2021)
(a) rRNA
(b) siRNA
(c) mRNA
(d) tRNA

Ans. b

  • In bacteria, there are three major types of RNAs: mRNA (messenger RNA), tRNA (transfer RNA), and rRNA (ribosomal RNA).
  • All three RNAs are needed to synthesise a protein in a cell.


Q.21. Which is the "Only enzyme" that has "Capability to catalyze Initiation, Elongation, and Termination in the process of transcription in prokaryotes?    (NEET 2021)
(a) DNA Ligase
(b) DNase
(c) DNA dependent DNA polymerase
(d) DNA dependent RNA polymerase

Ans. (d)
There is single DNA-dependent RNA polymerase that catalyses transcription of all types of RNA in bacteria.


Q.22. Which one of the following statements about Histones is wrong?    (NEET 2021)
(a) Histones are rich in amino acids - Lysine and Arginine.
(b) Histones carry a positive charge in the side chain.
(c) Histones are organized to form a unit of 8 molecules.
(d) The pH of histones is slightly acidic.

Ans. d

  • There is a set of positively charged, basic proteins called histones.
  • Histones are rich in the basic amino acid residues lysine and arginine.
  • Histones are organised to form a unit of eight molecules called histone octamer.
  • The negatively charged DNA is wrapped around the positively charged histone octamer to form a structure called nucleosome (Figure Given.

NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12


Q.23. Statement I: The codon 'AUG codes for methionine and phenylalanine.
Statement II: AAA' and 'AAG are both codons that code for the amino acid lysine.
In the light of the above statements, choose the correct answer from the options given below.
    (NEET 2021)
(a) Statement I is correct but Statement II is false
(b) Statement I is incorrect but Statement II is true
(c) Both Statement I and Statement II are true
(d) Both Statement I and Statement II are false

Ans. b

The Codons for the Various Amino Acids
NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12


Q.24. The first phase of translation is:    (NEET 2020)
(a) Aminoacylation of tRNA
(b) Recognition of an anti-codon
(c) Binding of mRNA to ribosome
(d) Recognition of DNA molecule

Ans. (a)
In translation the first phase is activation of amino acids in the presence of ATP. 

NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12

The activated amino acids are then linked to their cognate tRNAs, a process commonly called as charging of tRNA or aminoacylation of tRNAs.


Q.25. Name the enzyme that facilitates opening of DNA helix during transcription.    (NEET 2020)
(a) DNA polymerase
(b) RNA polymerase
(c) DNA ligase
(d) DNA helicase

Ans. (b)
RNA polymerase holoenzyme binds to the promoter, unwinds DNA (open complex) and form phosphodiester links between the initiating nucleotides. DNA polymerase, DNA ligase & DNA helicase are involved in the process of replication and not transcription.


Q.26. If the distance between two consecutive base pairs is 0.34 nm and the total number of base pairs of a DNA double helix in a typical mammalian cell is 6.6 × 109 dp, then the length of the DNA is approximately.    (NEET 2020)
(a) 2.2 meters
(b) 2.7 meters
(c) 2.0 meters
(d) 2.5 meters

Ans. a
The diploid content of human genome is 6.6 x 109 base pairs. The distance between two consecutive base pairs is 0.34 nm (0.34 x 10-9 m), so the length of DNA double helix in a typical mammalian cell is around 6.6 x 10-9 bp x 0.34 x 10-9m/bp = 2.2 metres.


Q.27. Match the following genes of the Lac operon with their respective products.    (NEET 2019)

 (A) I gene (i) β - galactosidase
 (B) z gene (ii) Permease
 (C) a gene (iii) Repressor
 (D) y gene (iv) Transacetylase

Select the correct option.


 (A) (B) (C) (D)
 (a) (iii) (iv) (i) (ii)
 (b) (i) (iii) (ii) (iv)
 (c) (iii) (i) (ii) (iv)
 (d) (iii) (i) (iv) (ii)

Ans. d
In lac operon
I gene → Repressor
z gene → β-galactosidase
y gene → Permease
a gene → Transacetylase


Q.28. Purines found both in DNA and RNA are    (NEET 2019)
(a) Cytosine and thymine
(b) Adenine and thymine
(c) Adenine and guanine
(d) Guanine and cytosine

Ans. c
Purines are the same in both DNA and RNA. They are adenine and guanine. Thymine, cytosine and uracil are pyrimidine bases. Cytosine is found in both DNA and RNA. Thymine is present in DNA and RNA contains uracil in place of thymine.


Q.29. Under which of the following conditions there will be no change in the reading frame of following mRNA?    (NEET 2019)
5' AACAGCGGUGCUAUU 3'
(a) Deletion of GGU from 7th, 8th and 9th positions
(b) Insertion of G at 5th  position
(c) Deletion of G from 5th position
(d) Insertion of A and G at 4th and 5th position respectively

Ans. a
Insertion or deletion of three or its multiple bases insert or delete one or multiple codon hence one or multiple amino acids, and reading frame remains unaltered from that point onwards.


Q.30. Expressed Sequence Tags (ESTs) refers to    (NEET 2019)
(a) Novel DNA sequences
(b) Genes expressed as RNA
(c) Polypeptide expression
(d) DNA polymorphism

Ans. b
Expressed Sequence Tags (ESTs) are genes that are expressed as RNA. It is used in sequencing of human genome.


Q.31. Which of the following features of genetic code does allow bacteria to produce human insulin by recombinant DNA technology?    (NEET 2019)
(a) Genetic code is specific.
(b) Genetic code is not ambiguous.
(c) Genetic code is redundant.
(d) Genetic code is nearly universal.

Ans. (d)
As genetic code is nearly universal means almost all organism (from a virus, bacteria to a tree or human being) will have amino acids coded by same kind of codons as given in checkerboard. So, this properties is utilised to produce human insulin using bacteria.


Q.32. What will be the sequence of mRNA produced by the following stretch of DNA?    (NEET 2019)
3'ATGCATGCATGCATG5'TEMPLATE 
STRAND
5' TACGTACGTACGTAC3' CODING 
STRAND
(a) 3'AUGCAUGCAUGCAUG5'
(b) 
5'UACGUACGUACGUAC 3'
(c) 
3' UACGUACGUACGUAC 5'
(d) 
5' AUGCAUGCAUGCAUG 3'

Ans. b
NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12


Q.33. Match the following RNA polymerase with their transcribed products:

 (1) RNA polymerase I (i) tRNA
 (2) RNA polymerase II (ii) rRNA
 (3) RNA polymerase III (iii) hnRNA 

Select the correct option from the following:    (NEET 2019)
(a) I-i, 2-iii, 3-ii
(b) 1-i, 2-ii, 3-iii
(c) 1 -ii, 2-iii, 3-i
(d) 1 -iii, 2-ii, 3-i

Ans. c


Q.34. Select the correct statement.    (NEET 2018)
(a) Franklin Stahl coined the term ‘‘ linkage ’’.
(b) Punnett square was developed by a British scientist.
(c) Spliceosomes take part in translation.
(d) Transduction was discovered by S. Altman.

Ans. b
Franklin Stahl along with Matthew Meselson proved semiconservative mode of replication in DNA. Punnett square was developed by a British geneticist, Reginald C. Punnett. Spliceosome formation is part of post-transcriptional change in eukaryotes. Transduction was discovered by Joshua Lederberg and Norton Zinder in the bacterium Salmonella.


Q.35. The experimental proof for semi-conservative replication of DNA was first shown in a    (NEET 2018)
(a) Fungus
(b) Bacterium
(c) Plant
(d) Virus

Ans. b
Semiconservative replication of DNA was proved by the work of Matthew Meselson and Franklin Stahl (1958) using bacterium Escherichia coli.


Q.36. Select the correct match.    (NEET 2018)
(a) Alec Jeffreys - Streptococcus pneumoniae
(b) Alfred Hershey and Martha Chase - TMV
(c) Matthew Meselson and F. Stahl - Pisum sativum
(d) Francois Jacob and Jacques Monod - Lac operon

Ans. d
Alec Jeffreys (1984) invented the DNA finger-printing technique. Alfred Hershey and Martha Chase proved that DNA is genetic material using T2 bacteriophages in an experiment. Matthew Meselson and F. Stahl proved semiconservative mode of replication in bacterium E. coli.


Q.37. Select the correct match.    (NEET 2018)
(a) Ribozyme - Nucleic acid
(b) F2 x Recessive parent - Dihybrid cross
(c) T.H. Morgan - Transduction
(d) G. Mendel - Transformation

Ans. a
Ribozymes (ribonucleic acid enzymes) are RNA molecules that are capable of catalysing specific biochemical reactions similar to the action of protein enzymes.


Q.38. Many ribosomes may associate with a single wiRNA to form multiple copies of a polypeptide simultaneously. Such strings of ribosomes are termed as    (NEET 2018)
(a) Polysome
(b) Polyhedral bodies
(c) Plastidome
(d) Nucleosome

Ans. a
The association of many ribosomes with single wRNA leads to formation of polyribosomes or polysomes. It occurs during translation process of protein synthesis.


Q.39. AGGTATCGCAT is a sequence from the coding strand of a gene. What will be the corresponding sequence of the transcribed mRNA?    (NEET 2018)
(a) AGGUAUCGCAU
(b) UGGTUTCGCAT
(c) ACCUAUGCGAU
(d) UCCAUAGCGUA

Ans. a
Coding strand and mRNA have same nucleotide sequence except, ‘T ’ - Thymine is replaced by 'U' - Uracil in mRNA.


Q.40. All of the following are part of an operon except    (NEET 2018)
(a) An operator
(b) Structural genes
(c) An enhancer
(d) A promoter

Ans. c
Operon concept is for prokaryotes that consist of operator gene, promoter gene, regulator gene and structural gene. Structural, operator and regulator genes are also present in eukaryotic gene expression along with enhancer gene but enhancer gene is present only in eukaryotic gene expression. It changes the rate of transcription of structural genes.


Q.41. The final proof for DNA as the genetic material came from the experiments of    (NEET 2017)
(a)
 Hershey and Chase
(b) Avery, MacLeod and McCarty
(c) Hargobind Khorana
(d) Griffith

Ans. a
Hershey and Chase gave unequivocal proof which ended the debate between protein and DNA as genetic material.


Q.42. If there are 999 bases in an RNA that code for a protein with 333 amino acids, and the base at position 901 is deleted such that the length of the RNA becomes 998 bases, how many codons will be altered?    (NEET 2017)
(a) 11
(b) 33
(c) 333
(d) 1

Ans. b
1 codon consists of 3 bases, Therefore, a deletion on 901 position will affect 33 codons.


Q.43. During DNA replication, Okazaki fragments are used to elongate    (NEET 2017)
(a) The lagging strand towards replication fork
(b) The leading strand away from replication fork
(c) The lagging strand away from the replication fork
(d) The leading strand towards replication fork

Ans. c
Lagging strand is a replicated strand 0f DNA which is formed in short segments called Okazaki fragments. Its growth is discontinuous. The direction of growth of the lagging strand is 3' → 5’ though in each Okazaki fragment it is 5’ → 3’.


Q.44. Which of the following RNAs should be most abundant in animal cell?    (NEET 2017)
(a) tRNA
(b) mRNA
(c) miRNA
(d) rRNA

Ans. d
rRNA (ribosomal RNA) is the most abundant of all types of RNA (70-88%). Hence, it will be present in highest amount. Percentage of tRNA and mRNA is 15% and 2-5% respectively. miRNA (micro RNA) are 21-22 bp long RNA that bring degeneration of mRNA.


Q.45. Spliceosomes are not found in cells of    (NEET 2017)
(a) Fungi
(b) Animals
(c) Bacteria
(d) Plants

Ans. c
Spliceosomes help in removal of introns. They will not occur in prokaryotes because prokaryotes do not have introns and thus, processing does not require splicing of mRNA.


Q.46. The association of histone H1 with a nucleosome indicates that    (NEET 2017)
(a) DNA replication is occurring
(b) The DNA is condensed into a chromatin fibre
(c) The DNA double helix is exposed
(d) Transcription is occurring

Ans. b
Histones help in packaging of DNA. In eukaryotes, DNA packaging is carried out with the help of positively charged basic proteins called histones. Histones are of five types - H1 H2A, H2B, H3 and H4. H1 is attached over the linker DNA. Histone contains a large proportion of the positively charged (basic) amino acids, lysine and arginine in their structure. DNA is negatively charged due to the phosphate groups on its backbone. The result of these opposite charges is strong attraction and therefore, high binding affinity between histones and DNA.


Q.47. Taylor conducted the experiments to prove semiconservative mode of chromosome replication on    (NEET 2016)
(a) 
Vinca rosea
(b) 
Vicia faba
(c) 
Drosophila melanogaster
(d) E. coli

Ans: b
Taylor et al. (1957) conducted experiment on Vicia faba (broad bean) to prove semiconservative replication of DNA. He fed dividing cells of root tips of Vicia faba with radioactive 3H containing thymine instead of normal thymine and found that all the chromosomes became radioactive. Labelled thymine was then replaced with normal one. Next generation came to have radioactivity in one of the two chromatids of each chromosome while in subsequent generation radioactivity was present in 50% of the chromosomes. This is possible only if out of the two strands of a chromosome, one is formed afresh while the other is conserved at each replication.


Q.48. The equivalent of a structural gene is    (NEET 2016)
(a) Muton
(b) Cistron
(c) Operon
(d) Recon

Ans. b
Cislron (or gene) is a length ot DNA that contains the information for coding a specific Polypeptide chain or a functional RNA molecule transfer RNA or ribosomal RNA). Hence, cistron is a unit of function. Currently such a gene is called structural gene.


Q.49. Which of the following rRNAs acts as structural RNA as well as ribozyme in bacteria?     (NEET 2016)
(a) 5S rRNA
(b) 18S rRNA
(c) 23S rRNA
(d) 5.8S rRNA

Ans. c
23S rRNA acts as structural RNA as well as ribozyme in bacteria.


Q.50. A molecule that can act as a genetic material must fulfill the traits given below, except    (NEET 2016)
(a) It should be able to express itself in the form of ‘Mendelian characters’
(b) It should be able to generate its replica
(c) It should be unstable structurally and chemically
(d) It should provide the scope for slow changes that are required for evolution.

Ans. c
Genetic material should be structurally and chemically stable otherwise its expression will change and lead to loss of several metabolic functions, etc.


Q.51. DNA-dependent RNA polymerase catalyses transcription on one strand of the DNA which is called the    (NEET 2016)
(a) Template strand
(b) Coding strand
(c) Alpha strand
(d) Antistrand

Ans. a
The strand of DNA on which RNA polymerase binds to catalyse transcription is called template strand. It is also known as master or antisense strand. It lias the polarity of 3' → 5'.


Q.52. Which one of the following is the starter codon?    (NEET 2016)
(a) UAA
(b) UAG
(c) AUG
(d) UGA

Ans. c
Polypeptide synthesis is signalled by two initiator codons or start codons i.c., AUG (methionine codon) and rarely by GUG (valine codon).


Q.53. Which of the following is required as inducer (s) for the expression of Lac operon?    (NEET 2016)
(a) Lactose
(b) Lactose and Galactose
(c) Glucose
(d) Galactose

Ans. a
In Lac operon, lactose is an inducer. It binds with suppressor and inactivates it. It allows RNA polymers access to the promoter and transcription proceeds.


Q.54. A complex of ribosomes attached to a single strand of RNA is known as    (NEET 2016)
(a) 
Polypeptide
(b) Okazaki fragment
(c) Polysome
(d) Polymer

Ans. c

  • Large clusters of 10 to 100 ribosomes, actively translating protein synthesis are called polysomes. The ribosomes in a polysome are connected by a single molecule of mRNA that is being translated simultaneously by many closely spaced ribosomes.
  • Polymers are large molecules composed of many monomer units. Polypeptide is large linear polymer of amino acids bonded together by peptide linkage.
  • Okazaki fragments are small nucleic acid fragments formed by discontinuous replication of lagging strand during DNA replication and are later joined together by DNA ligase enzyme.
The document NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12 is a part of the NEET Course Biology Class 12.
All you need of NEET at this link: NEET
158 videos|393 docs|239 tests
158 videos|393 docs|239 tests
Download as PDF
Explore Courses for NEET exam

How to Prepare for NEET

Read our guide to prepare for NEET which is created by Toppers & the best Teachers
Signup for Free!
Signup to see your scores go up within 7 days! Learn & Practice with 1000+ FREE Notes, Videos & Tests.
10M+ students study on EduRev
Download the FREE EduRev App
Track your progress, build streaks, highlight & save important lessons and more!
Related Searches

Previous Year Questions with Solutions

,

pdf

,

video lectures

,

practice quizzes

,

Summary

,

Semester Notes

,

Objective type Questions

,

Exam

,

NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12

,

MCQs

,

Viva Questions

,

Free

,

NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12

,

NEET Previous Year Questions(2016-23): Molecular Basis of Inheritance | Biology Class 12

,

mock tests for examination

,

Sample Paper

,

Extra Questions

,

ppt

,

Important questions

,

past year papers

,

shortcuts and tricks

,

study material

;