A research scholar has a mixture of proteins with the following properties.
Protein P → M.wt = 11 Kd; PI = 10
Protein Q →M.wt = 60 Kd: PI = 4
Protein R →M.wt = 26 Kd: PI = 8
Protein S→M.wt = 9 Kd; PI = 5
Predict the order of elution of these proteins when a mixture of the four proteins is separated by DEAE-cellulose chromatography at pH 7.
The following gel pattern was obtained in an attempt to sequence a DNA molecule using the Sanger method.
What is the sequence of the DNA molecule in question.
1 Crore+ students have signed up on EduRev. Have you? Download the App |
Which of the following methods of DNA isolation is most suitable for isolation of genomic DNA from plants?
The purification of an antigen using the corresponding antibodies conjugated to agrose is an example of
There is mention the temperature of different steps of PCR, find out the correct match
GST-tagged fusion protein will be purified by affinity chromatography by using which ligand?
Consider the following experimental distribution of a scientific data, obtained in one of the research lab, using flow cytometry method
One of the following inferences were drawn by the researcher is correct, mark the correct one.
Which of the following statements is not correct about gel electrophoresis?
Once, in a class of career endeavour academy having 225 students, weight of all the students was measured and data was represented in the form of mean±SEM as 70±3 If the all the data showed normal distribution, how many students are expected to have a weight exceeding 79 Kgs. would be approximately
Which of the following methods can be used to determine the molecular weight of a given polypeptide.
A scientist is working for the discovery of a biomarker for a particular disease. Find out the right options which he will used for this discovery.
One solution has absorbance of 0.50D, when path length of the cuvette is 1 cm. If this solution is diluted 10 times and 0.5 cm cuvette is used, the absorbance will be _______[Answer upto two decimal places]
Beginning with the 100 molecules of DNA templates, after 8 cycle of PCR, the number of amplicon will be ___________ [Answer in integer]
If the sequence of any DNA fragment is ATGCATGCATGCATGCATGC, its Tm (ºC) would be ___________ [Answer in integer]
This is the standard curve for gel filtration chromatography. If any unknown protein is eluting out from gel filtration chromatogram in 35 min, the approx. molecular weight of that protein will be ______ [Answer upto one decimal place]