Techniques MCQ


Test Description

21 Questions MCQ Test Mock Test Series of IIT JAM Biotechnology | Techniques MCQ

Techniques MCQ for IIT JAM 2022 is part of Mock Test Series of IIT JAM Biotechnology preparation. The Techniques MCQ questions and answers have been prepared according to the IIT JAM exam syllabus.The Techniques MCQ MCQs are made for IIT JAM 2022 Exam. Find important definitions, questions, notes, meanings, examples, exercises, MCQs and online tests for Techniques MCQ below.
Solutions of Techniques MCQ questions in English are available as part of our Mock Test Series of IIT JAM Biotechnology for IIT JAM & Techniques MCQ solutions in Hindi for Mock Test Series of IIT JAM Biotechnology course. Download more important topics, notes, lectures and mock test series for IIT JAM Exam by signing up for free. Attempt Techniques MCQ | 21 questions in 50 minutes | Mock test for IIT JAM preparation | Free important questions MCQ to study Mock Test Series of IIT JAM Biotechnology for IIT JAM Exam | Download free PDF with solutions
1 Crore+ students have signed up on EduRev. Have you?
Techniques MCQ - Question 1

A research scholar has a mixture of proteins with the following properties.

Protein P → M.wt = 11 Kd; PI = 10

Protein Q →M.wt = 60 Kd: PI = 4

Protein R →M.wt = 26 Kd: PI = 8

Protein S→M.wt = 9 Kd; PI = 5

Predict the order of elution of these proteins when a mixture of the four proteins is separated by DEAE-cellulose chromatography at pH 7.

Detailed Solution for Techniques MCQ - Question 1


As DEAE - cellulose is used that means fixed ion is positive charge in ion exchange chromatogram. So negative charge ions will be attracted and elute later.
So the P will elute first and then R and then S and finally Q.

Techniques MCQ - Question 2

The following gel pattern was obtained in an attempt to sequence a DNA molecule using the Sanger method.
What is the sequence of the DNA molecule in question.

Detailed Solution for Techniques MCQ - Question 2

By observing the given autoradiogram the sequence will come of amplified DNA so it will come
5’TACCTTGAT3’. So the sequence of the given DNA would be 5’ATCAAGGTA3’. 

Techniques MCQ - Question 3

Which of the following methods of DNA isolation is most suitable for isolation of genomic DNA from plants?

Detailed Solution for Techniques MCQ - Question 3

Cetyltrimethylammonium bromide is a cationic detergent that enables quick precipitation of cell debris and other biomolecules and hence help in separation of DNA especially from plants.

Techniques MCQ - Question 4

Which of the following is a non-parametric test?

Detailed Solution for Techniques MCQ - Question 4

Non-parametric test refer to statistical tests which do not involve numeric values (ordinal) but other indices like genetic ratios, degree of pain, etc. Chi square test is one such example. 

Techniques MCQ - Question 5

DNA-protein interaction can be determined by

Detailed Solution for Techniques MCQ - Question 5

DNA foot printing is use to identify DNA protein interaction. Bound protein in the DNA protect cleavage of DNA by nuclease. After banding pattern analysis it can be clearly observed.

Techniques MCQ - Question 6

The purification of an antigen using the corresponding antibodies conjugated to agrose is an example of

Detailed Solution for Techniques MCQ - Question 6

Affinity chromatography is the best method for protein purification. It is done by using specific affinity between the substrate to be isolated and molecule which can specific bind. So antigen can be purified by binding with antibody.

Techniques MCQ - Question 7

There is mention the temperature of different steps of PCR, find out the correct match

Detailed Solution for Techniques MCQ - Question 7

PCR is a technique which is use to amplify DNA invitro. It involves following steps.
(i) Denaturation at 94/95°C
(ii) Annealing at Tm± 4°
(iii) Extension at 72°C

Techniques MCQ - Question 8

GST-tagged fusion protein will be purified by affinity chromatography by using which ligand?

Detailed Solution for Techniques MCQ - Question 8

In affinity chromatography GST-tagged fusion protein can be purified by using Glutathione as ligand.

Techniques MCQ - Question 9

Consider the following experimental distribution of a scientific data, obtained in one of the research lab, using flow cytometry method

One of the following inferences were drawn by the researcher is correct, mark the correct one.

Detailed Solution for Techniques MCQ - Question 9

In case of unskewed or normal data, mean, median and mode coincide.

Techniques MCQ - Question 10

Polyacrylamide gel electrophoresis is performed for

Detailed Solution for Techniques MCQ - Question 10

Polyacrylamide gel electrophoresis is used to separate proteins and DNA less than 500 bp.

Techniques MCQ - Question 11

Which of the following statements is not correct about gel electrophoresis?

Detailed Solution for Techniques MCQ - Question 11

Electric field is dependent inversely on length of gel, it is related by the expression E = v/l, Where E is electric field, v is applied voltage and l is length of gel or distance between electrodes.

Techniques MCQ - Question 12

Once, in a class of career endeavour academy having 225 students, weight of all the students was measured and data was represented in the form of mean±SEM as 70±3 If the all the data showed normal distribution, how many students are expected to have a weight exceeding 79 Kgs. would be approximately

Detailed Solution for Techniques MCQ - Question 12

As per sigma rule a data which has normal distribution covers 68% of sample, hence weight in range of 70 ± 3 i.e. 67-73 would be covered  i.e. 153 students. While 99.5% sample coverage would be observed when we consider mean ± 3σ, i.e. 70 ±9 would cover 99.5% sample, hence number of students above and below 79 ks would be 225-  Hence 1 student would be above 79 kg and 1 below 61 kg.

*Multiple options can be correct
Techniques MCQ - Question 13

Which of the following methods can be used to determine the molecular weight of a given polypeptide.

Detailed Solution for Techniques MCQ - Question 13

Gel filtration chromatography, SDS-PAGE, MALDI-TOF mass spectroscopy all three used in the molecular weight determination while ChIP assay is used for DNA protein interaction.

*Multiple options can be correct
Techniques MCQ - Question 14

A scientist is working for the discovery of a biomarker for a particular disease. Find out the right options which he will used for this discovery.

Detailed Solution for Techniques MCQ - Question 14

2-D gel electrophoresis is used for the discovery phase in proteomics approach, whatever the proteins have been identified by 2-D gel electrophoresis then these are validates by either ELISA or western blot.

*Multiple options can be correct
Techniques MCQ - Question 15

There are methods which are used to study DNA-protein interaction

Detailed Solution for Techniques MCQ - Question 15

Super shift assay, DNA foot printing EMSA and ChIP assay all are used for DNA, protein interaction.

*Multiple options can be correct
Techniques MCQ - Question 16

Find the correct option from the following options

Detailed Solution for Techniques MCQ - Question 16

Polymerase chain reaction (PCR) is used for amplification of DNA in laboratory condition and is very much used in forensic science laboratory for application purpose. Its first step is denaturation, then annealing and  finally extension.

*Multiple options can be correct
Techniques MCQ - Question 17

Dideoxy DNA sequencing not exclusively depends on the following.

Detailed Solution for Techniques MCQ - Question 17

Dideoxy sequencing method is also known as chain termination method because after addition of dideoxy nucleotide, the growing chain terminates because of the absence of OH group in dideoxy nucleotide.

*Answer can only contain numeric values
Techniques MCQ - Question 18

One solution has absorbance of 0.50D, when path length of the cuvette is 1 cm. If this solution is diluted 10 times and 0.5 cm cuvette is used, the absorbance will be _______[Answer upto two decimal places]


Detailed Solution for Techniques MCQ - Question 18

 ...(i)
 ...(ii)

*Answer can only contain numeric values
Techniques MCQ - Question 19

Beginning with the 100 molecules of DNA templates, after 8 cycle of PCR, the number of amplicon will be ___________ [Answer in integer]


Detailed Solution for Techniques MCQ - Question 19

Mf = m1 x 2n
= 100 x 2
= 100 x 256
= 25600

*Answer can only contain numeric values
Techniques MCQ - Question 20

If the sequence of any DNA fragment is ATGCATGCATGCATGCATGC, its Tm (ºC) would be ___________ [Answer in integer]


Detailed Solution for Techniques MCQ - Question 20

Tm = 4(G + C) + 2(A + T)
=4(10) + 2(10)
=40 + 20 
=60°C

*Answer can only contain numeric values
Techniques MCQ - Question 21

This is the standard curve for gel filtration chromatography. If any unknown protein is eluting out from gel filtration chromatogram in 35 min, the approx. molecular weight of that protein will be ______  [Answer upto one decimal place]


Detailed Solution for Techniques MCQ - Question 21


Thats why17.5 Kd will be molecular weight.

Use Code STAYHOME200 and get INR 200 additional OFF
Use Coupon Code
Information about Techniques MCQ Page
In this test you can find the Exam questions for Techniques MCQ solved & explained in the simplest way possible. Besides giving Questions and answers for Techniques MCQ, EduRev gives you an ample number of Online tests for practice