All Exams >
Biotechnology Engineering (BT) >
Mock Test Series of IIT JAM Biotechnology 2026 >
All Questions
All questions of Methods in Biology for Biotechnology Engineering (BT) Exam
Once, in a class of career endeavour academy having 225 students, weight of all the students was measured and data was represented in the form of mean±SEM as 70±3 If the all the data showed normal distribution, how many students are expected to have a weight exceeding 79 Kgs. would be approximately- a)Zero
- b)One
- c)Twenty five
- d)Twelve
Correct answer is option 'B'. Can you explain this answer?
Once, in a class of career endeavour academy having 225 students, weight of all the students was measured and data was represented in the form of mean±SEM as 70±3 If the all the data showed normal distribution, how many students are expected to have a weight exceeding 79 Kgs. would be approximately
a)
Zero
b)
One
c)
Twenty five
d)
Twelve
|
Partho Gupta answered |
As per sigma rule a data which has normal distribution covers 68% of sample, hence weight in range of 70 ± 3 i.e. 67-73 would be covered 
i.e. 153 students. While 99.5% sample coverage would be observed when we consider mean ± 3σ, i.e. 70 ±9 would cover 99.5% sample, hence number of students above and below 79 ks would be 225- 
Hence 1 student would be above 79 kg and 1 below 61 kg.
i.e. 153 students. While 99.5% sample coverage would be observed when we consider mean ± 3σ, i.e. 70 ±9 would cover 99.5% sample, hence number of students above and below 79 ks would be 225- Hence 1 student would be above 79 kg and 1 below 61 kg.
The purification of an antigen using the corresponding antibodies conjugated to agrose is an example of- a)Hydrophobic interaction chromatography
- b)Affinity chromatography
- c)Ion-exchange chromatography
- d)Gel-filtration chromatography
Correct answer is option 'B'. Can you explain this answer?
The purification of an antigen using the corresponding antibodies conjugated to agrose is an example of
a)
Hydrophobic interaction chromatography
b)
Affinity chromatography
c)
Ion-exchange chromatography
d)
Gel-filtration chromatography
|
Sagarika Yadav answered |
Affinity chromatography is the best method for protein purification. It is done by using specific affinity between the substrate to be isolated and molecule which can specific bind. So antigen can be purified by binding with antibody.
Which of the following statements is not correct about gel electrophoresis?- a)Electrophoretic mobility of biomolecules is affected by their shape and size
- b)Electric field (E) is not affected by the length of gel
- c)Velocity of a molecule in electrophoretic gel is inversely related to the frictional drag encountered in the matrix of the gel
- d)Polyacrylamide gel can be used for nucleic acids separation
Correct answer is option 'B'. Can you explain this answer?
Which of the following statements is not correct about gel electrophoresis?
a)
Electrophoretic mobility of biomolecules is affected by their shape and size
b)
Electric field (E) is not affected by the length of gel
c)
Velocity of a molecule in electrophoretic gel is inversely related to the frictional drag encountered in the matrix of the gel
d)
Polyacrylamide gel can be used for nucleic acids separation
|
|
Niti Mukherjee answered |
Electric field is dependent inversely on length of gel, it is related by the expression E = v/l, Where E is electric field, v is applied voltage and l is length of gel or distance between electrodes.
Polyacrylamide gel electrophoresis is performed for- a)to separate proteins and DNA of size less than 500 bp
- b)to separate only proteins
- c)to separate only DNA
- d)to separate protein along with RNA
Correct answer is option 'A'. Can you explain this answer?
Polyacrylamide gel electrophoresis is performed for
a)
to separate proteins and DNA of size less than 500 bp
b)
to separate only proteins
c)
to separate only DNA
d)
to separate protein along with RNA
|
|
Om Desai answered |
Polyacrylamide gel electrophoresis is used to separate proteins and DNA less than 500 bp.
A research scholar has a mixture of proteins with the following properties.Protein P → M.wt = 11 Kd; PI = 10Protein Q →M.wt = 60 Kd: PI = 4Protein R →M.wt = 26 Kd: PI = 8Protein S→M.wt = 9 Kd; PI = 5Predict the order of elution of these proteins when a mixture of the four proteins is separated by DEAE-cellulose chromatography at pH 7.- a)P, R, S, Q
- b)Q, P, R, S
- c)Can not be predicted
- d)S, P, R, Q
Correct answer is option 'A'. Can you explain this answer?
A research scholar has a mixture of proteins with the following properties.
Protein P → M.wt = 11 Kd; PI = 10
Protein Q →M.wt = 60 Kd: PI = 4
Protein R →M.wt = 26 Kd: PI = 8
Protein S→M.wt = 9 Kd; PI = 5
Predict the order of elution of these proteins when a mixture of the four proteins is separated by DEAE-cellulose chromatography at pH 7.
a)
P, R, S, Q
b)
Q, P, R, S
c)
Can not be predicted
d)
S, P, R, Q
|
|
Shubham Rane answered |
As DEAE - cellulose is used that means fixed ion is positive charge in ion exchange chromatogram. So negative charge ions will be attracted and elute later.
So the P will elute first and then R and then S and finally Q.
A scientist is working for the discovery of a biomarker for a particular disease. Find out the right options which he will used for this discovery.- a)For the discovery phase he will use western BLOT or ELISA
- b)For the discovery phase he will use 2-D electrophoresis
- c)For the validating phase he will use western BLOT or ELISA
- d)For the validating phase he will use 2-D gel electrophoresis
Correct answer is option 'B,C'. Can you explain this answer?
A scientist is working for the discovery of a biomarker for a particular disease. Find out the right options which he will used for this discovery.
a)
For the discovery phase he will use western BLOT or ELISA
b)
For the discovery phase he will use 2-D electrophoresis
c)
For the validating phase he will use western BLOT or ELISA
d)
For the validating phase he will use 2-D gel electrophoresis
|
|
Srishti Khanna answered |
2-D gel electrophoresis is used for the discovery phase in proteomics approach, whatever the proteins have been identified by 2-D gel electrophoresis then these are validates by either ELISA or western blot.
GST-tagged fusion protein will be purified by affinity chromatography by using which ligand?- a)Nickle
- b)Concanavalin
- c)Polylysine
- d)Glutathione
Correct answer is option 'D'. Can you explain this answer?
GST-tagged fusion protein will be purified by affinity chromatography by using which ligand?
a)
Nickle
b)
Concanavalin
c)
Polylysine
d)
Glutathione
|
|
Sahana Sharma answered |
In affinity chromatography GST-tagged fusion protein can be purified by using Glutathione as ligand.
Dideoxy DNA sequencing not exclusively depends on the following.- a)Termination
- b)ATP
- c)Vector primer
- d)Plasmid vector
Correct answer is option 'B,C,D'. Can you explain this answer?
Dideoxy DNA sequencing not exclusively depends on the following.
a)
Termination
b)
ATP
c)
Vector primer
d)
Plasmid vector
|
|
Ishaan Sengupta answered |
Dideoxy sequencing method is also known as chain termination method because after addition of dideoxy nucleotide, the growing chain terminates because of the absence of OH group in dideoxy nucleotide.
If the sequence of any DNA fragment is ATGCATGCATGCATGCATGC, its Tm (ºC) would be ___________ [Answer in integer]
Correct answer is '60'. Can you explain this answer?
If the sequence of any DNA fragment is ATGCATGCATGCATGCATGC, its Tm (ºC) would be ___________ [Answer in integer]
|
|
Nandini Das answered |
Tm = 4(G + C) + 2(A + T)
=4(10) + 2(10)
=40 + 20
=60°C
=4(10) + 2(10)
=40 + 20
=60°C
Which of the following is a non-parametric test?- a)t-test
- b)ANOVA
- c)Chi square test
- d)All of the above
Correct answer is option 'C'. Can you explain this answer?
Which of the following is a non-parametric test?
a)
t-test
b)
ANOVA
c)
Chi square test
d)
All of the above
|
|
Ipsita Chopra answered |
Non-parametric test refer to statistical tests which do not involve numeric values (ordinal) but other indices like genetic ratios, degree of pain, etc. Chi square test is one such example.
Which of the following methods of DNA isolation is most suitable for isolation of genomic DNA from plants?- a)CTAB extraction method
- b)Alkaline lysis method
- c)Ethidium bromide method
- d)Phenol chloroform isopropanol method
Correct answer is option 'A'. Can you explain this answer?
Which of the following methods of DNA isolation is most suitable for isolation of genomic DNA from plants?
a)
CTAB extraction method
b)
Alkaline lysis method
c)
Ethidium bromide method
d)
Phenol chloroform isopropanol method
|
|
Palak Singh answered |
Cetyltrimethylammonium bromide is a cationic detergent that enables quick precipitation of cell debris and other biomolecules and hence help in separation of DNA especially from plants.
Which of the following methods can be used to determine the molecular weight of a given polypeptide.- a)Gel filtration chromatography
- b)SDS-PAGE
- c)MALDI-TOF mass spectroscopy
- d)ChIP assay
Correct answer is option 'A,B,C'. Can you explain this answer?
Which of the following methods can be used to determine the molecular weight of a given polypeptide.
a)
Gel filtration chromatography
b)
SDS-PAGE
c)
MALDI-TOF mass spectroscopy
d)
ChIP assay
|
|
Aditi Basak answered |
Gel filtration chromatography, SDS-PAGE, MALDI-TOF mass spectroscopy all three used in the molecular weight determination while ChIP assay is used for DNA protein interaction.
There is mention the temperature of different steps of PCR, find out the correct match- a)Denaturation 72ºC, Anealing 45ºC, Extension 92ºC
- b)Denaturation 94°C, Anealing = Tm±4°. Extension 72°C
- c)Denaturation and Extension 94°C' and Anealing = Tm±4°
- d)Denaturation 94°C, Anealing = Tm±4°. Extension 4°C
Correct answer is option 'B'. Can you explain this answer?
There is mention the temperature of different steps of PCR, find out the correct match
a)
Denaturation 72ºC, Anealing 45ºC, Extension 92ºC
b)
Denaturation 94°C, Anealing = Tm±4°. Extension 72°C
c)
Denaturation and Extension 94°C' and Anealing = Tm±4°
d)
Denaturation 94°C, Anealing = Tm±4°. Extension 4°C
|
|
Soumya Sharma answered |
PCR is a technique which is use to amplify DNA invitro. It involves following steps.
(i) Denaturation at 94/95°C
(ii) Annealing at Tm± 4°
(iii) Extension at 72°C
(i) Denaturation at 94/95°C
(ii) Annealing at Tm± 4°
(iii) Extension at 72°C
Beginning with the 100 molecules of DNA templates, after 8 cycle of PCR, the number of amplicon will be ___________ [Answer in integer]
Correct answer is '25600'. Can you explain this answer?
Beginning with the 100 molecules of DNA templates, after 8 cycle of PCR, the number of amplicon will be ___________ [Answer in integer]
|
|
Shilpa Datta answered |
Mf = m1 x 2n
= 100 x 28
= 100 x 256
= 25600
= 100 x 28
= 100 x 256
= 25600
...(i)
...(ii)
DNA-protein interaction can be determined by- a)DNA fingerprinting
- b)Northern hybridization
- c)ELISA
- d)DNA foot printing
Correct answer is option 'D'. Can you explain this answer?
DNA-protein interaction can be determined by
a)
DNA fingerprinting
b)
Northern hybridization
c)
ELISA
d)
DNA foot printing
|
|
Aashna Shah answered |
DNA foot printing is use to identify DNA protein interaction. Bound protein in the DNA protect cleavage of DNA by nuclease. After banding pattern analysis it can be clearly observed.
Consider the following experimental distribution of a scientific data, obtained in one of the research lab, using flow cytometry method
One of the following inferences were drawn by the researcher is correct, mark the correct one.- a)Data is left skewed and 1 represents mean, 2 represents median and 3 represents mode.
- b)Data is right skewed and 1 represents median, 2 represents mean and 3 represents mode
- c)Data is left skewed and 1 represents median, 2 represents mean and 3 represents mode.
- d)Data is right skewed and 1 represents mean, 2 represents median and 3 represents mode.
Correct answer is option 'A'. Can you explain this answer?
Consider the following experimental distribution of a scientific data, obtained in one of the research lab, using flow cytometry method
One of the following inferences were drawn by the researcher is correct, mark the correct one.
a)
Data is left skewed and 1 represents mean, 2 represents median and 3 represents mode.
b)
Data is right skewed and 1 represents median, 2 represents mean and 3 represents mode
c)
Data is left skewed and 1 represents median, 2 represents mean and 3 represents mode.
d)
Data is right skewed and 1 represents mean, 2 represents median and 3 represents mode.
|
|
Sahil Kapoor answered |
In case of unskewed or normal data, mean, median and mode coincide.
The following gel pattern was obtained in an attempt to sequence a DNA molecule using the Sanger method.
What is the sequence of the DNA molecule in question.
- a)5’ TACCTTGAT3’
- b)5’TAGTTCCAT3’
- c)5’ATGGAAGTA3’
- d)5’ATCAAGGTA3’
Correct answer is option 'D'. Can you explain this answer?
The following gel pattern was obtained in an attempt to sequence a DNA molecule using the Sanger method.
What is the sequence of the DNA molecule in question.
What is the sequence of the DNA molecule in question.
a)
5’ TACCTTGAT3’
b)
5’TAGTTCCAT3’
c)
5’ATGGAAGTA3’
d)
5’ATCAAGGTA3’
|
|
Mahi Dasgupta answered |
By observing the given autoradiogram the sequence will come of amplified DNA so it will come
5’TACCTTGAT3’. So the sequence of the given DNA would be 5’ATCAAGGTA3’.
5’TACCTTGAT3’. So the sequence of the given DNA would be 5’ATCAAGGTA3’.
This is the standard curve for gel filtration chromatography. If any unknown protein is eluting out from gel filtration chromatogram in 35 min, the approx. molecular weight of that protein will be ______ [Answer upto one decimal place]
Correct answer is between '17,18'. Can you explain this answer?
This is the standard curve for gel filtration chromatography. If any unknown protein is eluting out from gel filtration chromatogram in 35 min, the approx. molecular weight of that protein will be ______ [Answer upto one decimal place]
|
|
Dipanjan Sharma answered |
Thats why17.5 Kd will be molecular weight.
Find the correct option from the following options- a)PCR is used to renature the DNA molecules
- b)PCR is used to amplify the DNA molecules
- c)PCR is used in the laboratory of forensic science
- d)Extension of the DNA molecules is the very first step in this process and it is performed in 72ºC temperature.
Correct answer is option 'B,C'. Can you explain this answer?
Find the correct option from the following options
a)
PCR is used to renature the DNA molecules
b)
PCR is used to amplify the DNA molecules
c)
PCR is used in the laboratory of forensic science
d)
Extension of the DNA molecules is the very first step in this process and it is performed in 72ºC temperature.
|
|
Sagarika Yadav answered |
Polymerase chain reaction (PCR) is used for amplification of DNA in laboratory condition and is very much used in forensic science laboratory for application purpose. Its first step is denaturation, then annealing and finally extension.
There are methods which are used to study DNA-protein interaction- a)Super-shift assay
- b)DNA-foot printing
- c)EMSA
- d)ChIP assay
Correct answer is option 'A,B,C,D'. Can you explain this answer?
There are methods which are used to study DNA-protein interaction
a)
Super-shift assay
b)
DNA-foot printing
c)
EMSA
d)
ChIP assay
|
|
Raksha Pillai answered |
Super shift assay, DNA foot printing EMSA and ChIP assay all are used for DNA, protein interaction.
Chapter doubts & questions for Methods in Biology - Mock Test Series of IIT JAM Biotechnology 2026 2025 is part of Biotechnology Engineering (BT) exam preparation. The chapters have been prepared according to the Biotechnology Engineering (BT) exam syllabus. The Chapter doubts & questions, notes, tests & MCQs are made for Biotechnology Engineering (BT) 2025 Exam. Find important definitions, questions, notes, meanings, examples, exercises, MCQs and online tests here.
Chapter doubts & questions of Methods in Biology - Mock Test Series of IIT JAM Biotechnology 2026 in English & Hindi are available as part of Biotechnology Engineering (BT) exam.
Download more important topics, notes, lectures and mock test series for Biotechnology Engineering (BT) Exam by signing up for free.
Mock Test Series of IIT JAM Biotechnology 2026
7 docs|34 tests
|
|
© EduRev
|
Education Revolution
|
|
Signup on EduRev and stay on top of your study goals
10M+ students crushing their study goals daily