DNA stands for DeoxyriboNucleic Acid. Quite a mouthful, hence the handy abbreviation. It is a polymer of smaller units called nucleotides; hence, it is ‘nucleic’. Each nucleotide contains a 5 carbon sugar group (ribose), which lacks an oxygen atom (deoxy) at a key place, hence ‘deoxyribo’, a phosphate group, which is weakly acidic, hence ‘acid’, , and a base, which is actually the most important part. The result is deoxyribonucleic acid, or DNA, to save typing time. I find that biologists like long words… it makes us sound (and feel) clever.The phosphate and sugar groups are very similar to those which are ever-present in your body, cup of tea or bag of fertiliser, and these provide a solid backbone to the DNA, allowing it to hold its shape and not collapse into a nucleic acid-y mush. But the most important part of each nucleotide is the base. This is what makes up the code that defines the way we are. There are 4 bases in DNA, Adenine (A), Thymine (T), Cytosine (C) and Guanine (G), again handily abbreviated, and it is the order at which these occur within a DNA sequence that writes the code. For example, a simple piece of genetic code could read:ATGCATGGACTAACTCCTGTTAAACCGTTCAGC…This can go on for millions of bases, and it is this that makes up your genes and defines who you are. In fact there are 3 billion, that’s right… billion! bases in the tightly packed human genome. If this was all stretched out in a line it would have a length of 1 meter, but each cell contains 2 copies of the genome, so each tiny cell has 2 m of DNA squashed up inside it in the form of chromosomes. If all of the DNA in your body was stretched out like this it would reach the sun and back… 50 times!So if the DNA is formed of a series of bases in a long line, why is it a double helix? This comes down to the simple fact that the bases hate water, and are described as ‘hydrophobic’. The sugar-phosphate backbone, on the other hand, loves water; it can’t get enough of it! So it is termed ‘hydrophilic’. There is a huge amount of water cursing through our body at any one time, so it appears that the hydrophobic bases are in somewhat of a predicament. To solve this conundrum, two strands of DNA squash themselves together, with the hydrophobic bases facing in and the hydrophilic sugar-phosphate backbone facing out, allowing the bases to hide from the water. But this isn’t quite enough, if they stayed in this linear position, small water molecules can squeeze through the gaps and get to the bases, so the two strands of DNA tilt themselves and twist around one another, in an anti-clockwise direction, closing the gaps, meaning the bases stay nice and dry.The bases, however, do not always fit in this tight arrangement. Because they have to get so close to one another to exclude the water, they need to slot together very precisely, like jig-saw pieces. A and T can fit together very tightly, as can C and G, so these bases are always found in pairs, A on one strand will appear opposite a T on the other strand, as will C and G. Other matches are never seen, for example an A will never be opposite another A, C or G, as their shapes cannot sufficiently fit together. These bases then form weak interactions called hydrogen bonds, which hold the two strands together in a very stable and well-engineered structure. Clearly, this means that the two strands of DNA are not identical, in fact they are opposites of one another, and are described as being ‘complementary’. It does mean, however, that if the sequence one strand is known, the sequence of its complementary strand can be easily deduced. For example, if we look at the earlier sequence, we can write its complementary strand underneath it:ATGCATGGACTAACTCCTGTTAAACCGTTCAGC…TACGTACCTGATTGAGGACAATTTGGCAAGTCG…